Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pST39
Information
- Source/Vendor
- Tan Lab
- Plasmid Type
- Bacterial Expression
- Promoter
- T7
- Cloning Method
- Unknown
- Size
- 2800
- 5' Sequencing 1 Primer
- See map
- Bacterial Resistance
- Ampicillin
- Notes
- Reference: Tan, S. (2001) A Modular Polycistronic Expression System for Overexpressing Protein Complexes in E. coli, Prot Expr Purif, 21:224-234. Sequencing primers: T7 TAATACGACTCACTATAGGG M13 univ TGTAAAACGACGGCCAGT M13 -47 CGCCAGGGTTTTCCCAGTC M13 rev -48 AGCGGATAACAATTTCACA STO720 GCTAGTTATTGCTCAGCGG STO767 ACTGGCCGTCGTTTTACA STO768 GACTGGGAAAACCCTGGCG STO769 TGTGAAATTGTTATCCGCT
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified
Published Plasmid Map