-
Purpose(Empty Backbone) TALEN expression in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 48706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepZErO-2
-
Backbone manufacturerInvitrogen
- Backbone size (bp) 7210
-
Vector typeMammalian Expression, TALEN
- Promoter CAG
-
Selectable markersBlasticidin
-
Tag
/ Fusion Protein
- FokI nuclease (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer CGCTTGGAGGAATGCTCTGA
- 3′ sequencing primer AAGCGAGAGCGACCAGATGAT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe truncated TALE backbone and FokI wild-type sequences were PCR-amplified from plasmid pCAG-TAL-linker-IX_Fokwt kindly provided by Dr. Ralf Kühn.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Article describing generation and use of this plasmid is currently in revision
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTAL7b was a gift from Boris Greber (Addgene plasmid # 48706 ; http://n2t.net/addgene:48706 ; RRID:Addgene_48706) -
For your References section:
A modified TALEN-based system for robust generation of knock-out human pluripotent stem cell lines and disease models. Frank S, Skryabin BV, Greber B. BMC Genomics. 2013 Nov 9;14(1):773. 10.1186/1471-2164-14-773 PubMed 24206569