-
Purpose3rd generation lenti vector encoding dCAS9-VP64 with 2A Blast resistance marker (EF1a-NLS-dCas9(N863)-VP64-2A-Blast-WPRE)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61425 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Lentiviral Prep | 61425-LV | Virus (1mL at titer > 7x10⁵ TU/mL) and Plasmid. | $180 | ||
Concentrated Lentiviral Prep | 61425-LVC | Virus (50µL at titer > 1×10⁷ TU/mL) | $205 |
help@addgene.org for more information.
</p>
"
data-trigger="click"
data-click-away="true"
>
Discontinued
|
Backbone
-
Vector backboneplenti
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsnone
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCAS9(D10A, N863A)-VP64_2A_Blast
-
SpeciesSynthetic; S. pyogenes
-
MutationD10A and N863A in Cas9
- Promoter EF1A
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
- 3′ sequencing primer cacatagcgtaaaaggagcaacatag (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
IMPORTANT NOTE: If you intend to order the SAM library, this plasmid will come included with that order. Please do NOT order this plasmid if you are already planning to order the SAM library.
For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/
Information for Lentiviral Prep (Catalog # 61425-LV) ( Back to top)
Purpose
Ready-to-use Lentiviral Prep particles produced from lenti dCAS-VP64_Blast (#61425). In addition to the viral particles, you will also receive purified lenti dCAS-VP64_Blast plasmid DNA.
Delivery
- Volume 1 mL
- Titer ≥7x10⁵ TU/mL
- Pricing $150 USD for preparation of 1 mL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- ddPCR assay: 293T cells were transduced with serial dilutions of 61425-LV, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.
- PCR confirmation of insert: PCR was carried out with primers targeting Cas9 and the blasticidin-resistance gene. The PCR product was visualized on an agarose gel for size confirmation.
Forward Primer: dCas9-F2 CCAAAGAGGTGCTGGACG
Reverse Primer: Blast-R GCTCTTTCAATGAGGGTGGA
Visit our viral production page for more information.
Addgene Comments
While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for Cas9, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from Cas9 should expect similarly low titers.
To demonstrate that Addgene’s virus is fully functional, Addgene has generated stable cell lines from the Cas9-expressing lentiviruses. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.
Information for Concentrated Lentiviral Prep (Catalog # 61425-LVC) ( Back to top)
Addgene no longer distributes this item. Contact [email protected] for more information.
Virus (50µL at titer > 1×10⁷ TU/mL)
Purpose
Ready-to-use Concentrated Lentiviral Prep particles produced from lenti dCAS-VP64_Blast (#61425). In addition to the viral particles, you will also receive purified lenti dCAS-VP64_Blast plasmid DNA.
Delivery
- Volume 50 µL
- Titer ≥1×10⁷ TU/mL
- Pricing $175 USD for preparation of 50 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids psPAX2 (plasmid #12260)
- Envelope pMD2.G (plasmid #12259)
- Buffer PBS
- Selectable Marker Blasticidin
- Purification Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- ddPCR assay: 293T cells were transduced with serial dilutions of 61425-LVC, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.
- PCR confirmation of insert: PCR was carried out with primers targeting dCas9 and the blasticidin-resistance gene. The PCR product was visualized on an agarose gel for size confirmation.
Forward Primer: dCas9-F2 CCAAAGAGGTGCTGGACG Reverse Primer: Blast-R GCTCTTTCAATGAGGGTGGA
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti dCAS-VP64_Blast was a gift from Feng Zhang (Addgene plasmid # 61425 ; http://n2t.net/addgene:61425 ; RRID:Addgene_61425) For viral preps, please replace (Addgene plasmid # 61425) in the above sentence with: (Addgene viral prep # 61425-LV) or (Addgene viral prep # 61425-LVC) -
For your References section:
Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202